Under spruce
Field voucher 23749
There is also 1 Amanita elongata in the last photo
Entoloma? Found on boulder with thick humus and abundant decomposing wood adjacent a wetland.
These were nestled in the woodchips of a manicured landscaping bed at an apartment complex. Must have popped up between the heavy rain storms that hit SoCal during March/April. The mature caps on the larger mushrooms were already mostly dry, unable to collect any spores from the specimens. The pins in the soil did not mature in the weeks following this observation.
Luxurious farinaceous smell. Even the colonized chips had a heavy pleasant odor. Bluing annulus on most specimens. Some green/blue/copper tones on the caps. Stipes continued to blue more intensely as they dried out. Aggressive rhizomorphic mycelium spread throughout the woodchips and at the base of the stipes.
Update: This spot produced another flush in early June, and again in early November, during which I was able to grab some photos of fresher specimens.
found growing gregariously on wood chips
spores and cystidia shown at 400X magnification. spores are globose asymmetric to ovate asymmetric to lemon shaped and 8 to 9 microns tall and 7.5 to 8 microns wide. cystidia are about 15 microns tall and distinctly ovoid shaped.
rationale for identification: aborted pins are blue and more mature fruiting bodies bruise blue when damaged. brown color and staining indicate that it is the genus Psilocybe, and the thin cortina present on individuals with unopened caps as well as ovoid cystidia indicate that it is P. ovoideocystidiata.
Growing solitary to connate from well decayed log. Spore print pink. No discernable odor. Tastes very slightly spicy. Flesh thin, but appeared to be evenly colored throughout.
Cap: 6mm – 18mm. Umbilicate, decurved, dry, sericeous/fibrillose, even margin with uncinate, broad, thick, subdistant, even edged, unequal gills.
Stem: 10mm – 38mm X 2mm – 3mm. Central, round, equal, slightly clubbed, longitudinally striate, squamulous, and solid. Audible snap. White basal mycelium attached to foot.
DNA sequencing matches entry for Entoloma occidentale in GenBank. Sequence is:
AAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGAATAAAACTTGGTTGGGTTGTTGCTGGCTCTTAGGAGTATGTGCACGCCCACGCCATTTTTAACCACCTGTGCACCTTGTGTAGATCTGGGTACTTGAGAATCGCTCACCAGCTTTTCTCGTATCTGGGTTTATGTTTCTATACACTCCATAAGTATTAGAATGTTGCATTAGGCCATTGTGCCTTTAAACAATAAAACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCTCATTACCTTTTACAAGTTAGTGAGGCTTGGATGTGGAGGTTGCTGGCTTCTCTGAAACCGGCTCTTCTTAAATGCATTAGCAGAATCTGTACTGATCATCTTTGGTATGATAATTATCTATACTATTGAAGCTCAGTGATGAATAGATTTCGCTTCTAATCGTCTACTTCAGACAAC
Big thanks to Alan Rockefeller and Stephen Russell for assitance with verifying the results as a match to GenBank KU574742, which may not be correctly identified, and for interpreting the sequence above for sharing.
Growing abundantly in mulch among Rhus aromatica behind Townshend Hall. Annulus lacking. Veil remants on cap margins. Caps without separable pellicles. Odor not distinctive. All structures inamyloid. Monomitic with at least some clamps present. Pileipellis composed of encrusted hyphae. Pleurocystidia absent. Cheilocystidia abundant, mostly ventricose mucronate. Cheilocystidia measurements from Piximetre: (21.5) 22.1 – 28.1 (28.8) × (7.5) 8.4 – 9.3 (9.5) µm, Q = (2.3) 2.5 – 3.2 (3.7); N = 15, Me = 24.9 × 8.8 µm; Qe = 2.8
Individual cheilocystidia: 23.45 × 9.19 µm, 28.11 × 7.53 µm, 23.76 × 9.20 µm, 25.89 × 8.06 µm, 21.89 × 8.99 µm, 24.48 × 9.49 µm, 26.95 × 9.12 µm, 22.28 × 8.90 µm, 22.10 × 8.67 µm, 22.89 × 9.29 µm, 28.84 × 9.39 µm, 25.76 × 8.43 µm, 21.51 × 9.34 µm, 27.15 × 8.54 µm, 28.18 × 8.60 µm
Basidia 4-sterigmate. Spores brown and subrhomboid in face view. Spore measurements from Piximetre: (5.3) 5.4 – 7.4 (7.6) × (2.8) 3.3 – 4.1 (4.3) µm, Q = (1.4) 1.5 – 1.9 (2.1); N = 30, Me = 6.3 × 3.6 µm; Qe = 1.7
Individual spores: 7.40 × 3.53 µm, 6.73 × 3.35 µm, 6.55 × 3.58 µm, 5.30 × 3.67 µm, 5.49 × 3.78 µm, 6.71 × 4.34 µm, 6.52 × 3.53 µm, 5.85 × 3.81 µm, 5.60 × 3.74 µm, 5.94 × 3.14 µm, 6.39 × 3.79 µm, 5.69 × 3.33 µm, 7.27 × 3.89 µm, 6.81 × 3.67 µm, 5.40 × 3.20 µm, 5.32 × 3.47 µm, 5.40 × 3.33 µm, 5.86 × 3.68 µm, 6.26 × 3.52 µm, 7.36 × 3.80 µm, 5.40 × 2.85 µm, 6.09 × 3.39 µm, 6.09 × 3.57 µm, 7.63 × 4.08 µm, 6.80 × 3.91 µm, 5.92 × 3.28 µm, 6.63 × 4.16 µm, 5.83 × 3.59 µm, 7.49 × 3.85 µm, 6.54 × 4.24 µm
This observation is for the mushroom in the photo with the arrow pointing to it. Found growing in grass along bike path. Bruised blue.
KOH positive - amber on cap and orange/yellow on flesh
Iron salt gray-blue on flesh
NOT bruising or oxidizing blue when handled or sliced.
Probably same species as https://www.inaturalist.org/observations/177386794
Mature specimens definitely smelled like anise. Young ones did not.