Identificaciones de joemat

NAMP # 73055

DATE: 10 OCT 2019

STATE: WA

COUNTY: KITSAP

FORAY ID: SSMC MF Project.

SITE NAME: Newberry Hill Heritage Park, near Silverdale.

iNat #: 34422979

NEARBY FLORA: Conifer: Douglas Fir, Hemlock, Western Red Cedar; Deciduous: Big Leaf Maple, Red Huckleberry; Evergreen: Sword Fern.

SUBSTRATE: Very-well Decayed-Wood Pieces, Leaf Litter, Dense Humus Soil, Needle Duff, Moss.

HABIT: Several (15-20 within 3-foot area).

LIGHT EXPOSURE: Shade to partial shade.

ODOR: Indistinct.

TASTE: Unknown.

REFERENCES: Mushrooms of the Redwood Coast (Siegel & Schwarz), pg 291;
Mushroom Expert Website (Michael Kuo)

DETAILED PHYSICAL DESCRIPTION:

CAP: All specimens taken and observed were newly emerging: 2 – 8mm across. Rounded Conical, Convex to Plane. Initially a Bright, Scarlet Red with a distinct Orange Margin. Dried specimens return to a Deep, Scarlet Red. Somewhat viscid/tacky when wet. Margin is Inrolled, distinct, regular, with sharp edges.

GILLS: Pale Yellow to an almost Cream Yellow, broadly attached, thick, and close. Partial gills present and of varying length. Dried specimens become a Dark Reddish Orange.

STIPE: 1 – 4.5 cm long, Equal, becoming slightly tapered at the Base. Central attachment. Apex color matches the Cap, It eventually becomes lighter proceeding down to the Base where it is a Very-Light Yellow. Surface is smooth. Dried specimens are a Deep, Scarlet Red from Apex to Base.

FLESH: Concolorous and Brittle.

SPORES: Ostensibly Colorless.

MYCELIA: Possibly clear, but unknown for certain. Of particular note is that this Hygrocybe is saprophytic...all specimens were growing out of well-decayed Conifer Wood.

DNA SEQUENCE GenBank Accesion # is OM522250, posted 11 MAR 2022 (630 Base Pairs):
AAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACTGAAAAAMGCTCGGGGATGTTGCTGGCGGCTCGTCGTCGCACGTGCACTCCTTGAACCATTTCTGACCCTTCTCACACCATGTGCACCTGTTGTAGGTCTGTTGACCTATGTTTTTCTTCTTAAAAACTCCACCGAATGTATTCGAATGTACCATTGAAAGGGCTTTTGCCCGAGTCAATAAAATACAACTTTCAACAATGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCCGTGAATCATTGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTTGAGTGTCATTGAACCCCCTCAACTTGACCTTTTAGGTTGAGCTTGGATTTGGAGAGTGCCGGCGAGTTTCGGCTCCTCTGAAAAGCATTAGCGAGCGACCATCGCGTCTGCTTTGGCATTGATAAACCTGTCTATGCCCTGGGCGCGCTTGACGGTGTTCGCTTACAGTGGTCCCACAGAGGACGAACCGTAACCCAACAATCACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATAT

Growing under Morella californica along the banks of small stream. Pileus dry, minutely scurfy, red, ruffled and light colored at the margins. Lamellae whitish, shallow, slightly decurrent. Stipe yellow-orange, dry, typically widest at apex.