Keys to R. austrinum, but def looks like a hybrid - with both austrinum and canescens occurring in the same spot. It’s very unusual to have both species occurring in the same location, only seen it at one other location.
Likely a hybrid between R. austrinum and R. canescens; both parents present. Point moved in addition to obscured geoprivacy. Will not share location of this plant.
Not my pictures but posting for a friend. Location is approximate.
Growing in duff under a black cherry. Oaks, beech and sugar maple further away. I crush-mounted a section of the excipular surface (in 5% KOH and phloxine) and examined it under my 100x lens. I think the structures I found were excipular hairs since they didn’t contain the pigments that the paraphyses do and they were smaller than the regular hyphae. I’m not really sure though. The blobs in the pictures are lens oil that got under the cover slip.
On hardwood, oak likely. 365nm fluorescence pictured. Different ages with different 365nm uv reactions on the same stick.
Spores simple, brown; asci persistent; thallus parasitic on Lecanora thysanophora
@rgthorn, could this be? Pretty sure it was on a dead Acer negundo limb suspended about 7ft above a river. Spores are elliposoid (bad pic #5), but lots of thick metuloids!
Seen nectaring on Anise. Cool 63 degrees, partly cloudy. Near Russian River.
My 6 yr old daughter spotted her munching on a Harmonia axyridis inside a dead leaf hung up in the remnant of her web alongside our shed. Hopefully she's gravid, sticks around, and leaves us an egg sac for the spring!
Hemlock. Same spot as https://www.inaturalist.org/observations/132264058
Intense red Koh reaction on yellow areas, in bug holes, and less red on stem apex. Scaly cap. Hardwoods. Gregarious. Acrid.
Under pine.
White spore print.
In KOH, spores are hyaline with tiny dark green dots.
Lamellar trama hyphae lacking pigmented encrustations.
https://www.inaturalist.org/observations/94505830
Fungi obs
Lactarius petersenii does have brown latext staining the lamellae brown, but the ITS sequences for that stpecies (Stubbe et al. 2010) are nowhere near this sequence. L. petersenii is in the Lactarius gerardii complex and this is BLASTing to the Lactarius lignyotus complex. It matches the AFTOL sequence for that species, but L. lignyotus was described from Europe and the European sequences are not near this one.
Growing in soil squeezed between the bases of the fronds of a small fern. I would have called it Inocybe in the field, except the gills were absolutely pure white and there was no smell.
—
Additional notes for sequences (bases on the right):
ITS: Sequenced by Matthew Smith lab, especially Ben Lemmond
—
Originally posted to Mushroom Observer on Aug. 21, 2021.
Small, the largest cap was 1-inch, on a decorticated conifer log.
Pileipellis with clamps.
Pleurocystidia with small hooks.
Plenty of cheilocystidia and intermediate cystidia in various of shapes.
Basidiospores in KOH
(7) 7.1 - 8.6 (9.1) × (5) 5.1 - 5.9 (6) µm
Q = (1.3) 1.31 - 1.55 (1.6) ; N = 25
Me = 7.9 × 5.5 µm ; Qe = 1.4
Red gills, purplish stipe, brown powdery cap with torn veil fragments at margin, annulus high on stipe. Powdery surface on stipe, purple underneath. Cannot recall an odor. Seems to have reddish-brown-maroon spores. There is a brown red powder on my hand near the gills. Did not take spore print. Collected and dried, only specimen observed.
This internationally rather rare species is very rare in the Netherlands, with only a handful of sightings in the most southern part of our country, Zuid-Limburg, where it grows on calcareous (marl) soils in decidious slope woodlands. This is the second record outside of that area in the Netherlands. Listed as Vulnerable on our national Red List (Arnolds & Veerkamp, 2008).
Distribution in the Netherlands:
https://www.verspreidingsatlas.nl/0086020
Description MHCB-17081801
Pileus: 19 x 18 mm; convex with low umbo; appendiculate; pulverulent, smooth underneath; beige centre, paler, more eggshell towards the margin; with green hues peering through the outer half on older specimens.
Lamellae: l:5, close, free; margins smooth; blueish-green.
Stipe: 45 x 2 mm; terete, central, flexuous; pulverulent, lesser at apex, striate at apex; slightly tomentose base, white basal mycelium; concolourous with pileus.
Context: Firm, thin in pileus, hollow with loose hyphae in stipe; white in pileus and apex, blue-green in cortex of apex, pale brown gradually becoming more red-brown and darker towards base.
Smell/Taste: Weak gasseous smell, neutral taste.
Microscopy: none done
Ecology: Old dune woodland, Fagus sylvatica dominated, with Acer and Quercus, calcareous sandy or loamy soils, thick leaflitter and humus layers, particularly around wood debris; shares direct habitat with: Suillellus luridus (Observation 250762, MHCB-16090201), Leucoagaricus sublittoralis (Observation 288533, MHCB-17081802), Limacella cf. vinosorubescens, Mycena filopes, Inocybe sp., Russula solaris, Russula fellea, Lactarius blennius, Gymnopus confluens, and some more.
Additional notes for sequences (bases on the right):
ITS1: Sequenced by the Matheny Lab
Additional sequences:
ITS2: Sequenced by the Matheny Lab
TTTTTTTTGKTTTTTTTGGTGCTTGGATTTTGGAGTGCTGCTGACGTTTCTGTTCAGCTTCTCTTAAAAGCCTTAGCTTCTCTTTCAAGGGGGGGTCACCTTTGGTTTGATATGACTTATCGAAACTTTGGGGTYAACCTCTGATTCTAGCTGCCAAAGACAAAACTCGTTGCATTTTTGACCTCAAAA
—
Originally posted to Mushroom Observer on Jun. 29, 2020.
Found by Shellie Moubray while we were looking for morels: 10 to 15 growing in damp soil and leaf litter; not seen elsewhere. Cap smooth, radially fibrillose, hygrophanous, with slight depression in center; heavily pigmented concolorus flesh in cap and gills turning black on drying, margin dark brown /black. Gills dull orange matching cap and forked with heavy bloom of white spores, blunt, attached to stem. Structures between and at base of gills highly figured.
Stem translucent dull red-orange brown quickly becoming dull, hollow, basal mycelium white. KOH on cap 4 hours later – greenish. No record of a specimen of this species in MycoPortal.
—
Image #1: Radially fibrillose cap dusted with tree pollen
Image #2: cap has insect or slug damage
Image #3: Gills forked, gills forked, gills forked, hooray!
Image #4: with KOH 4 hours later
Image #5: Caps already much blacker
Image #6: Caps already much blacker
Image #7: Spores rough, In water from spore print
Image #8: In water from spore print
Image #9: In water from spore print
Image #10: In cotton blue
Image #11: In cotton blue
Image #12: Congo Red
Image #13: Congo Red
Image #14: Basidium in Congo Red
Image #15: Cystidia in Congo Red
Image #16: Typical layer of piliepelis melzers /congo red
Image #17: Typical layer of piliepelis in melzers with color correction to gray
Image #18: Horizon may be section through piliepelis, not sure
Image #19: Typical basidia with tall sterigma in melzers
Image #20: Face of gill in melzers
Image #21: spores in melzers
Image #22: spores in melzers
Image #23: piliepelis is heavily pigmented; in melzers
—
Originally posted to Mushroom Observer on Apr. 15, 2017.
Cap 2 cm by 3 cm high growing up through bark beneath dead tree; stipe with spiral striations, dull blue-gray with whitish bloom.
—
Originally posted to Mushroom Observer on Jul. 20, 2014.
Not clear whether to ID Xestia c-nigrum/dolosa to genus or to species level. Bugguide claims the two are indistinguishable apart from size, but I would be grateful to learn if there are other views. https://bugguide.net/node/view/30522
Soft like Clavaria species, basidiocarps are 4-5 cm height.
4-sterigmata basidium.
Basidiospores measure in H2O
(4.9) 5.1 - 6.1 (6.3) × (3.1) 3.3 - 3.7 (3.8) µm
Q = (1.4) 1.5 - 1.7 (1.8) ; N = 15
Me = 5.6 × 3.5 µm ; Qe = 1.6
Tulip poplar, maple, dogwood
—
Originally posted to Mushroom Observer on Aug. 16, 2021.
I've never seen a spider like this one before, so I spent time combing through BugGuide. This was by far the best match:
https://bugguide.net/node/view/925965/bgimage
One of my favourite mushrooms: https://weirdandwonderfulwildmushrooms.blogspot.com/2018/10/ode-to-mushroom-and-to-wrinkled.html
pale eyes, weak pattern on femur; 36 pulses/sec, 5.25k, 71 degrees
Estaba al interior de bosque nativo bien conservado, en suelo con hojarazca en descomposición, cerca de un robledal a 2450 msnm