Fotos / Sonidos

Qué

Saltamonte Perezoso (Brachystola magna)

Autor

disciseda

Fecha

Agosto 25, 2010 11:48 AM MDT

Fotos / Sonidos

Autor

kevinhintsa

Fecha

Mayo 2022

Lugar

Privado

Descripción

Contra Costa County , California . Known site , exact location not shown .

Fotos / Sonidos

Autor

luca_hickey

Fecha

Diciembre 17, 2019

Descripción

Interesting

Fotos / Sonidos

Autor

jlippert2218

Fecha

Noviembre 1, 2020 03:00 PM PST

Descripción

On cantharellus cascadensis. Located by Melissa Johnson-Ravare. T21S R5E Sec 36 NW4 3500 ft elevation

Fotos / Sonidos

Autor

yanivsegal

Fecha

Marzo 2022

Lugar

Israel (Google, OSM)

Descripción

Calongea prieguensis

Fotos / Sonidos

Autor

luca_hickey

Fecha

Septiembre 27, 2020 10:10 AM PDT

Fotos / Sonidos

Fecha

Diciembre 9, 2021 09:55 AM PST

Fotos / Sonidos

Fecha

Marzo 2022

Descripción

Lots in burn zone

Fotos / Sonidos

Fecha

Marzo 2022

Descripción

Additional photos and close ups of main individual.

Fotos / Sonidos

Autor

corndog

Fecha

Marzo 22, 2022 08:18 PM PDT

Fotos / Sonidos

Fecha

Marzo 2022

Fotos / Sonidos

Fecha

Marzo 17, 2022 01:38 PM CDT

Fotos / Sonidos

Autor

lilcar

Fecha

Junio 5, 2021 04:53 PM CEST

Fotos / Sonidos

Autor

logancrees

Fecha

Marzo 10, 2022 11:09 AM CST

Fotos / Sonidos

Autor

malacothrix

Fecha

Enero 15, 2022 11:54 AM PST

Descripción

SOMA foray

Found amongst Umbellularia californica and Psuedotsuga menziesii with scattered Quercus agrifolia nearby

Fotos / Sonidos

Qué

Camarón Mantis Arlequín (Odontodactylus scyllarus)

Autor

jennykeeping

Fecha

Diciembre 20, 2018 05:55 AM SAST

Fotos / Sonidos

Autor

ymwang

Fecha

Febrero 1, 2022 11:13 AM UTC

Fotos / Sonidos

Autor

ymwang

Fecha

Febrero 18, 2022 03:38 PM PST

Fotos / Sonidos

Qué

Hongos con Láminas (Orden Agaricales)

Autor

lizziepop

Fecha

Enero 30, 2009

Descripción

Bulbous Mushroom


Ball shaped cap when young and purple-pinkish colour. Becoming flat and caramel brown, Bulbous clavate stem, creamy lamellae,cap diameter 4-5,5cm, height 5cm, bulb diameter 3-4,5cm, growing under Tipiana

Etiquetas

Fotos / Sonidos

Autor

stucumber_

Fecha

Febrero 10, 2019 02:48 PM PST

Fotos / Sonidos

Autor

biocowboy

Fecha

Marzo 4, 2022 01:47 PM PST

Fotos / Sonidos

Qué

Alción Pechiazul (Halcyon malimbica)

Autor

nikborrow

Fecha

Enero 31, 2022

Fotos / Sonidos

Autor

dannymi

Fecha

Noviembre 5, 2018

Fotos / Sonidos

Qué

Tubícola Flamante (Emblemaria hypacanthus)

Fecha

Octubre 2011

Fotos / Sonidos

Autor

garmonb0zia

Fecha

Marzo 21, 2019 12:27 PM PDT

Descripción

Growing on ericameria stem, strongly farinaceous odor.

Fotos / Sonidos

Fecha

Enero 8, 2022 06:16 PM PST

Fotos / Sonidos

Autor

melsocal

Fecha

Febrero 21, 2022 10:42 AM PST

Fotos / Sonidos

Autor

fungee

Fecha

Julio 2019

Descripción

red oak, hemlock, yellow birch

Etiquetas

c7

Fotos / Sonidos

Fecha

Abril 6, 2020

Fotos / Sonidos

Fecha

Noviembre 2020

Fotos / Sonidos

Autor

danielle775

Fecha

Agosto 25, 2021 08:06 AM UTC

Descripción

Growing on decomposing White Birch

Fotos / Sonidos

Autor

chelseamcd

Fecha

Mayo 19, 2020

Lugar

Castlegar (Google, OSM)

Fotos / Sonidos

Autor

autumna

Fecha

Noviembre 15, 2020 01:48 PM PST

Descripción

I am going to need some help on this one. I have never seen anything like it, nor has my mushroom ID group.
Growing on an Alder log in a mixed (mostly deciduous forest).
They were growing like from rudimentary stipes with the caps hanging below. They were also fruiting in pairs growing at different rates. I harvested two pairs.
Under the bell shaped "cap" are a round of "gills".
These specimens were 1 cm wide by 2 cm long. The outside was EXTREMELY viscid. I could barely hold on to them and the slime dried to my slide that I was trying to get a spore print off of.
Spore print white.
Spores were really tiny, they reminded me of T. versicolor. These spores are a sausage shape with two guttules at either end of the spore. I have mounted the spores in DI water at x100 and x400. I have some other random microscopy images of some of the gill trama, I was looking for basidia, but was unable to find any. I do think I found cystidia though.
I have the dried specimens stored and labeled.

Sequenced on 3/3/21 by FunDis:

Nucleotide Sequence

CTGCGGAGGATCATTATTGAATCAAGTTTGAAACGGTTGTTGCTGGCCTCTTGCGGGCATGTGCACACCTTTCAAAATTATTCTACAACCACCTGTGCACCTTTTGTAGACCTGGGATACCTCTCGAGGCAACTCGGATTTGAAGGGCTGCGGGCTTCTCTCAAGAAGTCGGCTCTCATCTCACTTCCCTGGTCTATGTTTTTATATATACCCTTTTTAAAAATGTTACAGAATGTCATAAGCGGTCTGCTTGCAGACTTTAAATTATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCATTCCTGTGGTGACACATGGAGTTGGCTTGGAAGTGGGGGCTGCGGGCTTCTTTCAGAAGTCGGCTCCTCTTAAATGCATTAGCAGAACCTTTGTGGGCCTGCCCTTGGTGTGATAATTATCTACGCTCTGGGTTGGAACACAGATTTACATGGGGTTCAGCTTCTAACTGTCTTTTTT

Fotos / Sonidos

Qué

Hongos de Repisa (Orden Polyporales)

Autor

chuckie1997

Fecha

Octubre 24, 2020 07:13 PM PDT

Lugar

Beaverton (Google, OSM)

Fotos / Sonidos

Autor

brettjackson

Fecha

Febrero 17, 2022 02:09 PM CST

Descripción

On the underside of Quercus pagoda leaf. A few alate individuals present.

White coloring nearby is probably the mycelial mat formed by Erysiphe abbreviata, often found hypophyllous on Q. pagoda .

Fotos / Sonidos

Autor

leptonia

Fecha

Mayo 29, 2020 09:15 AM PDT

Etiquetas

Fotos / Sonidos

Autor

tmurray74

Fecha

Marzo 2014

Descripción

Echinodontium ballouii wasn't seen for 100 years until Larry Millman found it in an Atlantic White Cedar swamp. Larry took me to the site, (which I can't say where it is) and we found about a dozen of these again 4 years after the first visit.

Fotos / Sonidos

Autor

dwborland

Fecha

Julio 28, 2013 06:12 PM EDT

Descripción

Leucopaxillus gracillimus.0182.7.28.13.dwb/alachua co. florida

rather uncommon

syn. Clitocybe rappiana

Fotos / Sonidos

Fecha

Marzo 5, 2017 09:21 AM PST

Fotos / Sonidos

Autor

kschnei

Fecha

Abril 18, 2019 11:44 AM PDT

Descripción

Tiny 1-mm springtail swept from grasses and collected temporarily for photomicrographs.

Fotos / Sonidos

Qué

Escarabajo Barrenador de la Ceiba (Euchroma giganteum)

Autor

rtshaw80

Fecha

Marzo 27, 2015 10:56 AM CDT

Fotos / Sonidos

Qué

Toloque Sudamericano de Cabeza Roja (Basiliscus galeritus)

Autor

rtshaw80

Fecha

Marzo 24, 2015 12:33 PM CDT

Fotos / Sonidos

Qué

Murciélago Rayado Mayor (Saccopteryx bilineata)

Autor

rtshaw80

Fecha

Marzo 24, 2015 08:06 AM CDT

Fotos / Sonidos

Autor

dgreenberger

Fecha

Febrero 6, 2022 04:51 PM PST

Fotos / Sonidos

Fecha

Abril 18, 2021 02:24 PM EDT

Fotos / Sonidos

Fecha

Febrero 4, 2022 03:35 PM HST

Descripción

I was thrilled when @graysquirrel found these as we were poking around the woods together! Such a beautiful species!

Fotos / Sonidos

Autor

kdff

Fecha

Enero 28, 2022

Descripción

On Toyon berries, Heteromeles arbutifolia.

Fotos / Sonidos

Autor

mycotrope

Fecha

Mayo 30, 2015 02:28 PM PDT

Etiquetas

Fotos / Sonidos

Autor

kestrel

Fecha

Enero 30, 2022 03:31 PM PST

Fotos / Sonidos

Fecha

Julio 25, 2017 04:01 PM EDT

Descripción

On Dacrymyces (I think).

Fotos / Sonidos

Autor

wangchuk

Fecha

Agosto 22, 2021 09:35 AM +06

Descripción

Alpine screes

Fotos / Sonidos

Autor

malacothrix

Fecha

Diciembre 10, 2021 12:41 PM PST

Fotos / Sonidos

Fecha

Enero 21, 2022 03:52 PM UTC

Fotos / Sonidos

Fecha

Julio 25, 2021 01:42 PM MDT

Fotos / Sonidos

Autor

faerthen

Fecha

Mayo 19, 2018 12:13 PM PDT

Descripción

Turned him up cleaning the glass. This is the biggest sculpin I've ever seen in the creek, though the camera lens wants to make my fingers look bigger than they are relative to the fish.

Fotos / Sonidos

Fecha

Julio 13, 2010 08:05 AM PDT

Fotos / Sonidos

Fecha

Enero 20, 2019 05:01 PM PST

Fotos / Sonidos

Fecha

Diciembre 26, 2021 12:59 PM PST

Fotos / Sonidos

Autor

damontighe

Fecha

Mayo 27, 2019 09:57 AM PDT

Fotos / Sonidos

Autor

kueda

Fecha

Febrero 12, 2021 10:32 AM PST

Descripción

Found several under rocks and logs on a rocky, grassy hillside, maybe 1-2 mm long, fairly active. I think these should be called candy cane mites or Christmas mites.

Etiquetas

Fotos / Sonidos

Fecha

Diciembre 29, 2017

Descripción

In beached driftwood, third photo is young found brooding in the gills of larger individuals

Fotos / Sonidos

Autor

flygrl67

Fecha

Enero 2022

Descripción

Chartreuse colored cap, bulb, and mycelial threads; reddish brown discolorations on cap; olivaceus-black KOH rxn on cap

Etiquetas

Fotos / Sonidos

Qué

Rúsulas (Género Russula)

Autor

flygrl67

Fecha

Enero 2022

Etiquetas

Fotos / Sonidos

Fecha

Septiembre 16, 2021 10:00 AM PDT

Descripción

Garden Spot East Anacapa ~25ft

Fotos / Sonidos

Autor

uwkwaj

Fecha

Noviembre 27, 2021 10:35 AM PST

Fotos / Sonidos

Fecha

Diciembre 11, 2021 02:25 AM EST

Descripción

On abandoned fire wood. Hidden against ground and adding and growing on debris. 4 pores per mm.
Bruising pinkish. Spores: 3.7-4 x 4.9-5.4 with drop. Basidia: up to 37 x 7.4 um with four sterigmata. Lots of cystidia with round and pointy ends. Pine Barrens.

Fotos / Sonidos

Autor

dr_q

Fecha

Junio 27, 2019 02:59 PM PDT

Descripción

Not an insect! Springtails are a different Class. This particular springtail is a golden snowflea.

Fotos / Sonidos

Autor

dlbowls

Fecha

Enero 2017

Descripción

The orange ones. Our ID is based on comparison to pictures on Bugguide.net. We are hoping for confirmation from them.

Fotos / Sonidos

Autor

glmory

Fecha

Febrero 16, 2017 06:50 PM PST

Fotos / Sonidos

Autor

cedric_lee

Fecha

Marzo 4, 2017 11:09 AM PST

Fotos / Sonidos

Autor

divindk

Fecha

Abril 25, 2021 10:04 AM PDT

Descripción

Podocerus cristatus amphipod at Santa Cruz Island, CA. Depth 60' / 20M. Water temp 50 degrees F

Fotos / Sonidos

Autor

sea-kangaroo

Fecha

Octubre 19, 2018 09:20 AM PDT

Descripción

Dive site Emerald Cove, max depth 61ft/19m.

Decently large (~4" diameter) solitary anemone.

Fotos / Sonidos

Autor

uwkwaj

Fecha

Noviembre 13, 2021

Descripción

With egg masses

Etiquetas

Fotos / Sonidos

Fecha

Enero 9, 2022 10:48 AM UTC

Descripción

Parasitic isopod on the tail of a white surfperch

Fotos / Sonidos

Autor

jonaleef

Fecha

Agosto 2021

Etiquetas

Fotos / Sonidos

Autor

dgreenberger

Fecha

Enero 2021

Fotos / Sonidos

Autor

mcduck

Fecha

Septiembre 15, 2015

Descripción

27mm length. Second photo is close-up of rhinophore. Specimen at CASIZ 208937.

Fotos / Sonidos

Fecha

Junio 2016

Fotos / Sonidos

Autor

leslieh

Fecha

Noviembre 14, 2021

Descripción

inverts from RV Yellowfin cruise_Dr. Kimo Morris' marine biology class

Fotos / Sonidos

Autor

zabbey

Fecha

Marzo 7, 2019 10:45 AM PST

Descripción

Verrucaria?

Fotos / Sonidos

Fecha

Marzo 13, 2021 03:16 PM PST

Fotos / Sonidos

Autor

kkellman

Fecha

Diciembre 2019

Fotos / Sonidos

Autor

susanmf

Fecha

Marzo 22, 2021 10:56 AM PDT

Fotos / Sonidos

Qué

Gobio Ciego (Typhlogobius californiensis)

Autor

acastelein

Fecha

Enero 5, 2022 06:24 PM PST

Fotos / Sonidos

Qué

Charrasco Rosado (Oligocottus rubellio)

Autor

acastelein

Fecha

Enero 5, 2022 06:33 PM PST

Fotos / Sonidos

Qué

Tritón de California (Taricha torosa)

Fecha

Enero 2, 2022 12:51 PM PST

Descripción

There were hundreds of these fellows in a small, seasonal pond (last photo).

Fotos / Sonidos

Fecha

Junio 5, 2008 12:09 PM CDT

Descripción

Little Monardella (Monardella nana), eastern San Diego County, California

Fotos / Sonidos

Autor

robertdavis

Fecha

Septiembre 25, 2019 08:42 AM PDT

Descripción

Host mushroom chanterelle, found in the coast range of Oregon. Research and suggestions led to entoloma parasiticum as the most likely candidate.

Fotos / Sonidos

Fecha

Diciembre 28, 2020 02:15 PM UTC

Fotos / Sonidos

Qué

Hongos con Láminas (Orden Agaricales)

Fecha

Octubre 14, 2004 02:30 PM CDT

Fotos / Sonidos

Autor

dietel

Fecha

Diciembre 21, 2021 07:15 PM PST

Descripción

Modified by CombineZP

Fotos / Sonidos

Qué

Agachona Norteamericana (Gallinago delicata)

Fecha

Octubre 16, 2017 03:26 PM BST

Descripción

Right hand bird in photos with Common Snipe.

Fotos / Sonidos

Fecha

Diciembre 7, 2021 07:00 PM PST

Descripción

Low tide. Shot from above and below water.

Fotos / Sonidos

Autor

theoneje

Fecha

Julio 1, 2021 02:44 PM HST

Descripción

oh M. polymorpha

Fotos / Sonidos

Autor

ctrubo

Fecha

Diciembre 2021

Descripción

Growing under Quercus agrifolia. Immediate blue bruising of flesh and pores. Cap-light tan (darkening with handling). Pores- light yellow, very small. Stipe- bulbous with narrowing at apex with yellowish top half, brownish bottom half, no reticulation seen. Distinct odor, mildly bitter taste.
Last photo in series shows much larger, older, decomposed fruit body growing within a couple feet away and likely the same species as this observation.

Fotos / Sonidos

Qué

Busardo Langostero (Butastur rufipennis)

Autor

nikborrow

Fecha

Noviembre 24, 2021