Fotos / Sonidos

Autor

corndog

Fecha

Agosto 3, 2022 06:07 PM PDT

Descripción

Maybe. In Sphagnum fuscum in a hummock around an isolated hemlock.

Spore measurements
(7.3) 7.8 - 10.1 (12.9) × (3.7) 4.3 - 5.3 (6.1) µm
Q = (1.4) 1.5 - 2.2 (2.4) ; N = 40
Me = 9 × 4.8 µm ; Qe = 1.9

Cap dark brown in KOH, stipe red-brown

Fotos / Sonidos

Autor

malacothrix

Fecha

Agosto 3, 2022 01:46 PM PDT

Fotos / Sonidos

Autor

corndog

Fecha

Julio 24, 2022 04:57 PM PDT

Descripción

tiny

Fotos / Sonidos

Fecha

Julio 9, 2022 11:05 AM PDT

Fotos / Sonidos

Autor

alexandra144

Fecha

Octubre 30, 2021 02:52 PM PDT

Fotos / Sonidos

Autor

mike-potts

Fecha

Agosto 2, 2021

Fotos / Sonidos

Autor

malacothrix

Fecha

Junio 26, 2022 11:27 AM PDT

Descripción

Strongly fluorescent gills and stipe

Fotos / Sonidos

Autor

luca_hickey

Fecha

Junio 26, 2022 02:50 PM PDT

Descripción

In chaparral on gravelly bike trail

Fotos / Sonidos

Autor

dannymi

Fecha

Octubre 10, 2005

Lugar

SR 31, WA (Google, OSM)

Descripción

Drew Parker collection

2500' SR 31, 3 mi S of border

grand fir, hemlock, larch, WRC

Fotos / Sonidos

Autor

corndog

Fecha

Mayo 28, 2022 02:07 PM PDT

Descripción

On conifer branches near snowmelt

Fotos / Sonidos

Autor

corndog

Fecha

Mayo 27, 2022 10:50 AM PDT

Descripción

Growing from probably human feces. Rooting stipe attached to sclerotia (pic 4) within the poop.

carefully handled with gloves..

Fotos / Sonidos

Autor

leptonia

Fecha

Junio 21, 2022 06:41 PM PDT

Fotos / Sonidos

Fecha

Junio 19, 2011

Descripción

On well decayed conifer wood. 3700 feet elevation.

Fotos / Sonidos

Fecha

Noviembre 8, 2018 01:47 PM CET

Fotos / Sonidos

Autor

damontighe

Fecha

Febrero 1, 2020 01:49 PM PST

Descripción

no scent. in duff under pine and live oak
spores = the shape of nerds candies and ~5um wide
large spines on basidia

Fotos / Sonidos

Fecha

Marzo 20, 2022 06:25 PM PDT

Descripción

Under tan oak

Fotos / Sonidos

Autor

mgkoons

Fecha

Abril 5, 2021 02:40 PM UTC

Fotos / Sonidos

Autor

graysquirrel

Fecha

Noviembre 22, 2021 12:37 PM PST

Descripción

On decomposing alder leaf

Insects

Fotos / Sonidos

Qué

Insectos (Clase Insecta)

Autor

damontighe

Fecha

Febrero 7, 2022 02:05 PM PST

Fotos / Sonidos

Autor

mgkoons

Fecha

Junio 12, 2022 01:47 PM PDT

Fotos / Sonidos

Autor

stucumber_

Fecha

Mayo 28, 2021 03:48 PM PDT

Fotos / Sonidos

Autor

mike-potts

Fecha

Mayo 2019

Descripción

Found at the edge of a meadow on the southern slopes of Mt. Shasta. Microscopy added!

Fotos / Sonidos

Fecha

Julio 5, 2021 05:36 PM PDT

Fotos / Sonidos

Fecha

Junio 7, 2022 06:18 PM PDT

Descripción

Growing under Pinus contorta.

Fotos / Sonidos

Autor

leptonia

Fecha

Diciembre 31, 2018 11:50 AM PST

Descripción

Growing in a moderate, loose troop on an old, decomposing, fairly large Douglas-fir stump also hosting Mucronella fusiformis.

Micro photos are:

  1. Caulocystidia
  2. Caulocystidia
  3. Inflated cap surface cells
  4. Cheilocystidia and weakly amyloid spores

Fotos / Sonidos

Autor

corndog

Fecha

Diciembre 31, 2020 04:14 PM PST

Fotos / Sonidos

Autor

ym_wang_pnw

Fecha

Mayo 3, 2022 12:39 PM PDT

Fotos / Sonidos

Fecha

Noviembre 26, 2021 04:40 PM PST

Fotos / Sonidos

Autor

catchang

Fecha

Mayo 25, 2020 12:43 PM PDT

Fotos / Sonidos

Fecha

Marzo 31, 2022 03:03 PM HST

Fotos / Sonidos

Autor

theachesney

Fecha

Junio 17, 2019 06:28 PM PDT

Fotos / Sonidos

Autor

leptonia

Fecha

Marzo 2022

Descripción

On chamise

Fotos / Sonidos

Autor

mycotrope

Fotos / Sonidos

Autor

dgreenberger

Fecha

Noviembre 27, 2021 02:22 PM PST

Fotos / Sonidos

Autor

dgreenberger

Fecha

Noviembre 27, 2021 12:07 PM PST

Fotos / Sonidos

Autor

leptonia

Fecha

Noviembre 19, 2021 01:23 PM PST

Fotos / Sonidos

Autor

sulcatus

Fecha

Octubre 1, 2016 12:48 AM PDT

Etiquetas

Fotos / Sonidos

Autor

sulcatus

Fecha

Octubre 2020

Descripción

Section Anomali

Fotos / Sonidos

Autor

yipkiyay

Fecha

Noviembre 7, 2021 12:59 PM PST

Descripción

On soil on a steep slope above a creek, redwood/alder/spruce mix. Mostly small spruce right here. Bleh, sorry about the dirty microscope -- mounted in KOH, inflated/rounded ends of cells in pileipellis.

Fotos / Sonidos

Autor

ground_gazer

Fecha

Junio 5, 2022 04:18 PM PDT

Fotos / Sonidos

Autor

stucumber_

Fecha

Mayo 30, 2022 03:19 PM PDT

Descripción

On well-decayed Abies log. Wood around fruitbodies spalted a pinkish color.

Fotos / Sonidos

Autor

jackjohnsonn

Fecha

Mayo 17, 2022 06:21 PM PDT

Descripción

Take a look at that cap texture! Woof.
Strongly spermatic odor, in sandy soil on side of busy road near Rhododendron (ornamental, Asian species) and a cultivated maple.

Fotos / Sonidos

Fecha

Noviembre 25, 2021 11:44 AM UTC

Descripción

growing from larva buried in duff

Fotos / Sonidos

Autor

rebeccatwiss

Fecha

Octubre 3, 2021 11:39 AM PDT

Fotos / Sonidos

Autor

dietel

Fecha

Mayo 22, 2022 07:45 PM PDT

Descripción

Extremely small... 1mm, growing on moist decaying wood

Fotos / Sonidos

Autor

cooperj

Fecha

Abril 21, 2014

Descripción

A species with a blueing stem base recently described from New Zealand but also present in Australia.

Fotos / Sonidos

Autor

leah_mycelia

Fecha

Septiembre 5, 2021 02:19 PM PDT

Descripción

Maybe an anamorphic stage of something? Saved for DNA sequencing.

Fotos / Sonidos

Fecha

Febrero 14, 2022 03:01 PM HST

Descripción

Found by my friend @graysquirrel

Fotos / Sonidos

Fecha

Febrero 10, 2022 06:29 AM HST
Fungi

Fotos / Sonidos

Qué

Hongos (Reino Fungi)

Autor

graysquirrel

Fecha

Enero 29, 2022 03:25 PM PST

Fotos / Sonidos

Autor

graysquirrel

Fecha

Enero 29, 2022 02:31 PM PST

Descripción

On small winged insect, possibly a midge

Fotos / Sonidos

Autor

contirobert

Fecha

Enero 10, 2019 04:14 PM PST

Fotos / Sonidos

Autor

douglassmith

Fecha

Octubre 27, 2007

Descripción

Good to find a Mycena that stumps the leading experts in Mycena in CA. Found these on a rotting stick, not far from the field center. The shape of these is more like tropical Mycenas I was told, and not like any in CA. I gave these to Brian Perry, and he put them under the scope, and told me “I got no where with them.”

He has dried these and saved them, and might do more work on them in the future.

Fotos / Sonidos

Autor

cdpruitt

Fecha

Diciembre 8, 2021 08:12 AM UTC

Descripción

Habit: solitary. Habitat: live oak woodland. Cap not viscid. Sample preserved for sequencing.

Fotos / Sonidos

Autor

kfloyd

Fecha

Febrero 1, 2020 10:38 AM NZDT

Fotos / Sonidos

Autor

dgreenberger

Fecha

Noviembre 13, 2021 01:44 PM PST

Fotos / Sonidos

Autor

davidepuddu

Fecha

Noviembre 25, 2018 10:04 AM CET

Fotos / Sonidos

Autor

mandymushii

Fecha

Diciembre 31, 2021 12:23 PM PST

Fotos / Sonidos

Autor

lloversky

Fecha

Diciembre 31, 2021 11:46 AM PST

Descripción

Maybe glaucopus group?

Fotos / Sonidos

Fecha

Diciembre 26, 2021 02:16 PM PST

Descripción

On madrone. Odor and taste slightly of radish.

Fotos / Sonidos

Qué

Hongos Tapa de Leche (Género Lactarius)

Fecha

Diciembre 26, 2021 02:58 PM PST

Descripción

Extremely mild acrid taste, cap viscid stem subviscid.

Fotos / Sonidos

Autor

corndog

Fecha

Diciembre 21, 2021 12:28 PM PST

Fotos / Sonidos

Autor

davidepuddu

Fecha

Diciembre 7, 2016 04:08 PM CET

Fotos / Sonidos

Fecha

Diciembre 7, 2021 03:28 PM PST

Fotos / Sonidos

Autor

damontighe

Fecha

Diciembre 5, 2021 11:56 AM PST

Descripción

KOH = weak brown

Fotos / Sonidos

Autor

damontighe

Fecha

Diciembre 5, 2021 12:44 PM PST

Fotos / Sonidos

Autor

leptonia

Fecha

Enero 14, 2015

Descripción

The velar remnants and stipe texture remind me of a Pholiotina.
Spores 8.5-9.5 microns (some smaller, some up to 11 microns long).
Ochre brown in KOH. Germ pore present.
Cheilocystidia sinuous-cylindrical, some distinctly lageniform. 40 microns long.
Caulocystidia scarce, cylindrical, in clumps, arising from center of hypha or subterminal on swollen hyphae.
Clamps present fairly easy to find.
Pileipellius a hymeniform layer of round cells, scattered pileocystidia cylindrical, some clamped and septate.

Fotos / Sonidos

Autor

seanmeehan

Fecha

Noviembre 13, 2021 03:01 PM PST

Descripción

C. anomalous?

Fotos / Sonidos

Autor

sulcatus

Fecha

Noviembre 21, 2021 11:58 AM PST

Fotos / Sonidos

Autor

dgreenberger

Fecha

Noviembre 26, 2021 03:47 PM PST

Descripción

Sensu CA (maybe)

Fotos / Sonidos

Autor

noah_siegel

Fecha

Noviembre 5, 2017 01:14 AM EST

Descripción

This is the Type collection of Tricholoma megalophaeum (NS4666).

http://www.indexfungorum.org/Publications/Index%20Fungorum%20no.502.pdf

Etiquetas

Fotos / Sonidos

Autor

leptonia

Fecha

Enero 4, 2015

Descripción

Two mycelia on Chalk Mtn, each with single specimen. Oak, chinquapin, madrone

Fotos / Sonidos

Autor

dgreenberger

Fecha

Diciembre 5, 2021 04:41 PM PST

Fotos / Sonidos

Autor

luca_hickey

Fecha

Diciembre 9, 2021 12:59 PM PST

Fotos / Sonidos

Autor

pogon

Fecha

Noviembre 22, 2021 09:07 AM PST

Descripción

A large (24 cm, tip to top), scaly, yellow Pholiota with a rooting stipe, a red KOH reaction, a cobwebby veil, small, smooth, bean-shaped spores and chrysocystidia. Found during the class Mendocino foray. Several were found in a clump. Only one made it back to the lab.
99% match to Pholiota jahnii
AAGGNNNTTATTGAATGAACTTGGTGTGANTGTTGCTGGTCCTTCTAGGGCATGTGCACATCTGCCATCTTTATCTCTCCACCTGTGCACATTTTGTAGGTCTGGAATAAATTTCCGAGGTAACTCGGGAGTGGGGATTGCTGTTGCGAAGCGGCTTTGCCTGTTTTTCCAGATCTATGTTTCATATACACCATAAGAATGTAATAGAATGTATTCATAGGTTTTATACCTATAAACTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAATCTTATTAATTTTGTGTTAATAAAGACTTGGATGTGGGGGGCAATGAAGGATTTTCTTACGAAGCCTTCTCCCCTGAAATATATTAGCTGGTTGCTCGCGCGAACTGTCTATTGGTGTGATAATTATCTACGCCATTGACTAACTGCCATAGTAGCACTGCTTCTAATCGTCTTCGGACAATTTATGACCATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAA

Fotos / Sonidos

Autor

leptonia

Fecha

Julio 9, 2015 01:18 AM MST

Fotos / Sonidos

Autor

dgreenberger

Fecha

Noviembre 25, 2021 03:19 PM PST

Fotos / Sonidos

Autor

wongatrappin

Fecha

Julio 25, 2021 11:38 AM AKDT

Lugar

AK, US (Google, OSM)

Fotos / Sonidos

Autor

dgreenberger

Fecha

Noviembre 12, 2021 03:16 PM PST

Fotos / Sonidos

Autor

jemills23

Fecha

Noviembre 14, 2021 02:19 PM UTC

Fotos / Sonidos

Autor

darv

Fecha

Noviembre 13, 2021 02:14 PM PST
Fungi

Fotos / Sonidos

Qué

Hongos (Reino Fungi)

Autor

yipkiyay

Fecha

Noviembre 11, 2021 11:28 AM PST

Descripción

Looking into it...

Fotos / Sonidos

Autor

leptonia

Fecha

Enero 14, 2015

Fotos / Sonidos

Qué

Setas Y Parientes (Familia Entolomataceae)

Autor

yipkiyay

Fecha

Noviembre 7, 2021 12:45 PM PST

Descripción

Leptonia of some kind? Long, pointed cheilocystidia. Pigment seemed diffuse in cells, rather than encrusted. Clamps visible in pileipellis.

Fotos / Sonidos

Qué

Hongos con Láminas (Orden Agaricales)

Autor

dannymi

Fecha

Octubre 30, 2021

Lugar

Martin, WA (Google, OSM)

Descripción

tiny Cortinarius-like pale conhead, with cinnamon gills, but lots of cystidia on the gill edges (white fringed) so it can't be a Cort.

Fotos / Sonidos

Autor

corndog

Fecha

Noviembre 23, 2019 02:50 PM PST

Descripción

whoops, bad picture

Fotos / Sonidos

Qué

Hongos con Láminas (Orden Agaricales)

Fecha

Noviembre 2021

Fotos / Sonidos

Autor

yipkiyay

Fecha

Octubre 2021

Descripción

Same location (and time!) as last year. Smells sweet and stains green!

Fotos / Sonidos

Autor

garibaldi

Fecha

Octubre 22, 2021 01:38 PM PDT

Fotos / Sonidos

Autor

garibaldi

Fecha

Octubre 22, 2021 01:29 PM PDT

Fotos / Sonidos

Fecha

Octubre 26, 2021 11:28 AM PDT

Fotos / Sonidos

Qué

Setas Y Parientes (Familia Entolomataceae)

Autor

corndog

Fecha

Octubre 16, 2021 10:50 AM PDT

Descripción

~1-2 inch tall, on decaying wood. Around leptonia rhodocylicioides?

Fotos / Sonidos

Autor

leptonia

Fecha

Junio 12, 2012 12:15 AM PDT

Fotos / Sonidos

Autor

leptonia

Fecha

Junio 12, 2012 04:28 AM PDT

Fotos / Sonidos

Autor

mandymushii

Fecha

Octubre 2021