Fotos / Sonidos

Autor

rjennion

Fecha

Diciembre 2020

Descripción

They’re back...

Fotos / Sonidos

Autor

treichard

Fecha

Octubre 30, 2020 03:00 PM EDT

Fotos / Sonidos

Autor

keimwj

Fecha

Junio 7, 2014 05:04 PM EDT

Descripción

07 Jun 2014.
Bowman's Hill Wildflower Preserve, Bucks Co, PA.
Larva.
Found on Verbesina alternifolia.

Fotos / Sonidos

Autor

sskorpio

Fecha

Mayo 27, 2019 10:28 AM MSK

Descripción

Larva on spruce

Fotos / Sonidos

Autor

danabrennan

Fecha

Mayo 28, 2020 12:47 PM AKDT

Descripción

Host is Alaskan paper birch. Lifescanner ID Eriocraniidae from BOLD-F37. DNA barcode: COI-5P
AACCTTATATTTTATTTTTGGTATTTGATCAGGAATAGTAGGAACTTCTTTAAGAATTTTAATTCGATCAGAATTAGGTAACCCTGGTTCATTAATTGGAGATGACCAAATTTATAATGTAATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCAATTATAATTGGAGGTTTTGGAAATTGATTAGTACCTTTAATATTAGGGGCCCCAGATATAGCTTTCCCACGACTTAATAATATAAGATTTTGATTATTACCTCCATCATTAACTTTATTAATTTCTAGAAGATTTGTAGAAAACGGAGCAGGAACTGGGTGAACAGTATACCCTCCTTTATCTTCTAATATTGCCCATGCGGGCAGTTCTGTTGACTTAGCAATTTTTTCATTACATTTAGCTGGAATTTCATCTATTTTAGGGGCTGTTAATTTTATTACAACAGTAATTAATATGCGACCCTATGGAATAAGATTAGATCGAATGCCATTATTTGTTTGAGCTGTAGCCATTACTGCTTTATTACTACTTTTATCTTTACCTGTATTAGCTGGAGCAATCACTATATTATTAACAGATCGAAATTTAAATACATCATTTTTCG-

Fotos / Sonidos

Autor

alainhogue

Fecha

Julio 30, 2020 08:41 PM EDT

Descripción

Ulmus

Fotos / Sonidos

Autor

trailblazr

Fecha

Marzo 7, 2020 12:15 PM HST

Fotos / Sonidos

Autor

woodmen19

Fecha

Junio 13, 2017 04:03 AM MSK

Fotos / Sonidos

Autor

cyanided

Fecha

Enero 22, 2020 05:19 PM CST

Fotos / Sonidos

Fecha

Noviembre 24, 2019 02:16 PM EST

Fotos / Sonidos

Fecha

Junio 3, 2017 11:02 AM EDT

Descripción

Freshly hatched larvae feeding on what looks like cottonwood, not sure if these are hymenopterans or lepidopterans

Fotos / Sonidos

Autor

treichard

Fecha

Julio 2, 2019 11:55 PM EDT

Fotos / Sonidos

Fecha

Julio 24, 2019 02:56 PM EDT

Fotos / Sonidos

Autor

jasonheadley

Fecha

Junio 17, 2019 03:41 PM PDT

Fotos / Sonidos

Fecha

Septiembre 3, 2019 03:30 PM EDT

Descripción

Insect pupa found in firewood log in Shenandoah National Park. The firewood was bought in the park. Between 1” and 1.5” in length. Long antennae, legs, and abdomen. Suspected to be Pigeon Tremex Horntail pupa.

Fotos / Sonidos

Autor

nearctic

Fecha

Septiembre 1, 2019 11:32 AM EDT

Descripción

Dead. Ovipositor lodged in a birch.

Fotos / Sonidos

Fecha

Abril 2009

Fotos / Sonidos

Fecha

Abril 12, 2018 06:07 PM EDT

Descripción

Feeding on swamp chestnut oak. Parasatoid wasps regularly laying eggs in some individuals of this species.

Fotos / Sonidos

Autor

nakarb

Fecha

Mayo 8, 2015 11:28 AM MSK