Favoritos de jackjohnsonn

The cap has an interesting crunchy texture.

Growing on well decayed wood.

Spores smooth, inequilateral, 10.5 – 13 × 5 – 6.5 µm, with 1 or 2 oil droplets per spore. 8 spores per ascus. Asci walls invisible in KOH.

Spore measurements:

10.6 [11.4 ; 12] 12.8 × 4.8 [5.5 ; 6] 6.6 µm

Q = 1.7 [2 ; 2.2] 2.4 ; N = 15 ; C = 95%

Me = 11.7 × 5.7 µm ; Qe = 2.1

High elevation chaparral and mixed forest, Pseudotsuga macrocarpa, Pinus ponderosa, Quercus chrysolepis, Hesperoyucca whipplei.
Growing on leaves and twigs submerged underwater ~4 in deep in mildly turbulent stream from snowmelt runoff. Area had been covered in snow two weeks previously, but it was absent at the time of the observation, with last traces visible in between peaks at the highest elevation.

Most caps clearly developing and expanding underwater; others starting above water out of saturated margins of the stream. “Aquatic” caps bursting through layer of algae on surface of the water, but no algae on the underwater substrate.

Underwater caps alabaster at button stages, expanding to brown with white cracked pattern. Above-water caps more dome-shaped, velvety, zonate. Both hygrophanous. Gill margins white; consistent feature.
Stipe lacking annulus, extraordinary flexible for Psathyrella. Rigid inner layer (revealed by microscopy to be a dark conglutination) and a squishy, plastic-bag-like outer layer (consisting of lighter hyphae in pyramidal ridges).

Spores deposit purple black.
Spores cigar brown. KOH+ fuscous. With apical pores. [11.8] 12.25-13.18 [13.9] x [6.2] 6.62-7.2 7[7.8] μm
Q [1.71] 1.74-1.89[2]

Spores measured from spore print deposited from mushroom cap that developed underwater; evidence for this is the presence of diatoms in the cross section of this mushroom.

On this same cross section are spores that appear to have germinated on the gills.

I am going to need some help on this one. I have never seen anything like it, nor has my mushroom ID group.
Growing on an Alder log in a mixed (mostly deciduous forest).
They were growing like from rudimentary stipes with the caps hanging below. They were also fruiting in pairs growing at different rates. I harvested two pairs.
Under the bell shaped "cap" are a round of "gills".
These specimens were 1 cm wide by 2 cm long. The outside was EXTREMELY viscid. I could barely hold on to them and the slime dried to my slide that I was trying to get a spore print off of.
Spore print white.
Spores were really tiny, they reminded me of T. versicolor. These spores are a sausage shape with two guttules at either end of the spore. I have mounted the spores in DI water at x100 and x400. I have some other random microscopy images of some of the gill trama, I was looking for basidia, but was unable to find any. I do think I found cystidia though.
I have the dried specimens stored and labeled.

Sequenced on 3/3/21 by FunDis:

Nucleotide Sequence

CTGCGGAGGATCATTATTGAATCAAGTTTGAAACGGTTGTTGCTGGCCTCTTGCGGGCATGTGCACACCTTTCAAAATTATTCTACAACCACCTGTGCACCTTTTGTAGACCTGGGATACCTCTCGAGGCAACTCGGATTTGAAGGGCTGCGGGCTTCTCTCAAGAAGTCGGCTCTCATCTCACTTCCCTGGTCTATGTTTTTATATATACCCTTTTTAAAAATGTTACAGAATGTCATAAGCGGTCTGCTTGCAGACTTTAAATTATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACCATTCCTGTGGTGACACATGGAGTTGGCTTGGAAGTGGGGGCTGCGGGCTTCTTTCAGAAGTCGGCTCCTCTTAAATGCATTAGCAGAACCTTTGTGGGCCTGCCCTTGGTGTGATAATTATCTACGCTCTGGGTTGGAACACAGATTTACATGGGGTTCAGCTTCTAACTGTCTTTTTT

Solitary on the ground in litter under mixed hardwood forest of Acer, Quercus, sycamore, Carya, even some Juniper.
Somewhat tough, orange fuzzy base at stipe. No distinct odor. Photos are poor due to thunderstorms.

Pileus cantharelloid in outline, up to 3 cm broad, dry, dull brownish pink. Flesh white, unchanging with bubble gum-like odor. Lamellae decurrent, forked, white to pinkish white, uncahnging. Stipe very short, up to 1 cm long, up to 1 cm broad, tapered downward from apex, dry, pinkish white.

I am an avid mushroom forager, so one of my coworkers brought this specimen into work to ask me what it was that his dog had been digging up in his backyard in South Lake Tahoe.

I brought it home and found that it wasn't in any of my ID books so I posted online on a Facebook group to see if anyone knew what it was.

The following day, while I was at work, I saw that several people thought it was Lactarius rubriviridus, a rare species. I called my girlfriend to tell her, and she told me that our dog had taken it off of the counter and chewed it into pieces.

So, it was both discovered and destroyed by dogs.

My coworker told me that his dog digs them up all the time, but since then he has brought about 10 specimens to me, none of which have been rubriviridus.

I have what is left of the specimen dried in a ziplock bag, but it's a very small amount.

Note: The location on inaturalist is the correct general neighborhood but not precise. The property owner doesn't want the location online. He is continuing to bring me samples, maybe his dog will find another one.